Question.1277 - Group Exam 4: Transcription, Translation, and Mutation Spring 2024 Group # ______ Members of the group listed in alphabetical order please! 1 2 3 4 5 Single letter codes for amino acids ala (alanine)Agly (glycine)Gphe (phenylalamine)F arg (arginine)Rhis (histidine)Hpro (proline)P asn (asparagine)Nile (isoleucine)Iser (serine)S asp (aspartic acid)Dleu (leucine)Lthr (threonine)T cys (cysteine)Clys (lysine)Ktrp (tryptophan)W glu (glutamic acid)Emet (methionine)Mtyr (tyrosine)Y gln (glutamine)Qval (valine)V Please use the chart above and the following prokaryotic DNA sequence below to answer the following questions. All of the questions in this exam use the same DNA sequence. 5non-template DNA strand +1 3 GTTTGACACCGCATGGCCGGCTCGTATAATGTATGGATGCCCAGGACATGGAACTCGTTATCAGCTTGATTGTGGAGTCCTAAGGTGC What is the name and function of the sequence on the diagram above from the 5 end to +1 that are marked in bold? A. What do you predict would happen if you mutated the sequences labeled -35 or -10? Explain your answer. What do you predict would happen if you deleted the sequences between the sequences labeled -35 and -10? Explain your answer. What is the sequence of the mRNA? Be sure to point out which are the 5 and 3 ends. Note: You can ignore the transcription termination signal that would be present (due to the very large size of the stem-loop structure that signals transcription termination, this signal has been left out). Please create a line drawing of a prokaryotic mRNA that codes for 2 proteins, A and B. Note you do not have to indicate the sequence of all actual nucleotides, only those that are essential to translation (if a consensus sequence is known, please indicate what that is), but include any important components you will find on your mRNA and label them. Also please indicate the function of any sequences provided. Be sure to label all important sequences. How would a eukaryotic mRNA differ from the one you drew for question 4, including all forms that would be seen from transcription until translation? What is the amino acid sequence coded for by this mRNA sequence? What is the message? Please use the single letter codes for each amino acid to decipher the message. Hints: 1) The fmet amino acid is often deleted from the finished protein in prokaryotes, and 2) The message should actually say something to you in English. You must show all your work to get any credit! How many amino acids will be in your final protein BEFORE post-translational modifications? How many ATP/GTP will be used to perform translocations in the production of this protein? How many ATP/GTP will be used to perform peptidyl transferase reactions in the production of this protein? How many ATP/GTP will be used to add amino acids to tRNAs in the production of this protein? How many ATP/GTP will be used to initiate the production of this protein? How many ATP/GTP will be used to terminate the production of this protein? How many ATP/GTP will be used by elongation factors to bring tRNAs with amino acids attached into the ribosome? Assume that an error has occurred during DNA replication, and the DNA has a mutation in the base sequence at the site where the base nucleotide is written in bold and underlined. Please decipher the new message. non-template DNA strand+1 5 GTTTGACACCGCATGGCCGGCTCGTATAATGTATGGATGCCCAGGACATGGAACTCGTTATCAGCTGGATTGTGGAGTCCTAAGGTGC 3 What is the sequence of the new protein message? Please use the single letter codes for each amino acid to decipher the message. Again show all your work. Could this mutation be a frameshift mutation? Why or why not? Assume than an error has occurred during DNA replication, and the new DNA strand has a mutation in the base sequence, such that the nucleotide that is in bold and underlined has been inserted into the normal sequence. Please decipher the new message. non-template DNA strand +1 5 GTTTGACACCGCATGGCCGGCTCGTATAATGTATGGATGCCCAGGACATGGAACTCGTTATCAGCTTGATTGTGGGAGTCCTAAGGTGC 3 What is the sequence of the new message? Please use the single letter codes for each amino acid to decipher the message. Again, show all your work. Could this mutation be a frameshift mutation? Why or why not? You perform an enzymatic rate of reaction analysis on two mutants of an enzyme and obtain the following data. (Note: These are not the mutants above.) 1323833274800 For mutant 1 shown in the graph above, indicate if the mutations listed below could be the type of mutation you are observing. Please state yes, no, or maybe and explain your answer. Mutant #1 silent nonsense frameshift Neutral Missense You perform an enzymatic rate of reaction analysis on two mutants of an enzyme and obtain the following data. (Note: These are not the mutants above.) For mutant 2 shown in the graph above, indicate if the mutations listed below could be the type of mutation you are observing. Please state yes, no, or maybe and explain your answer. Mutant #2 silent nonsense frameshift Neutral Missense The Page of Dissent Students who disagree with the answers provided by the group can register their dissent from their groups answer on this page. If you disagree with your groups answer and you are RIGHT, you will get back the points your group lost. If you disagree with your groups answer and you are WRONG only those people who dissent will lose points. How to dissent: State the question to which you would like to dissent, your dissent and a brief justification. Students who dissent must sign their names to the dissent. If there are multiple dissents, then each dissent must be signed individually. Only students who have signed their names to a dissent will get credit for it if they are correct, so make sure you sign all dissents you wish to make. Note: if we cannot determine to which question you dissent, we will not grade the dissent, so make sure you are very clear.
Answer Below:
Answer not updated
Answer xxx updatedPaying someone to do your biology assignment has become a practical solution for students managing tight deadlines, academic pressure, and personal responsibilities. Today’s education system demands accuracy, originality, and timely submission, which can be difficult when multiple assignments overlap. Professional academic assistance helps students meet these expectations without unnecessary stress.
When you choose to pay someone to complete your biology assignment, you gain access to experienced academic writers who understand university guidelines, grading criteria, and plagiarism standards. These experts deliver well-structured, properly researched, and original work that aligns with your academic requirements. Whether the assignment involves analysis, problem-solving, or concept explanation, professional help ensures clarity and relevance.
Time management is another major advantage. Assignments often require extensive research and formatting, consuming hours or even days. By outsourcing your biology assignment, you can focus on exams, projects, or other priorities while ensuring your work is completed on time. Quality and confidentiality also matter. Reputable academic support platforms keep your personal information secure and provide plagiarism-free content written from scratch. Many services offer revisions, allowing improvements based on instructor feedback.
Seeking help with your biology assignment does not mean avoiding learning. Instead, it provides a useful reference to better understand concepts, improve writing skills, and maintain consistent academic performance. Paying someone to do your biology assignment can be a smart and efficient academic choice.